ADH1B (Alcohol Dehydrogenase 1B)
Why is Alcohol Dehydrogenase 1B important? It codes for a protein (alcohol dehydrogenase) that plays a key role in the process of ethanol metabolization, which is how the body processes ethanol, the kind of alcohol found in all spirits and liqueurs. Alcohol Dehydrogenase 1B converts the toxic ethanol into other molecules that can then be processed. This means that Alcohol Dehydrogenase 1B is essential in our ability to tolerate alcoholic drinks. Some variants render the human body less capable of tolerating alcohol, and so a person is less able to drink. Other variants increase the human tendency to become dependent on alcohol.
Location of ADH1B on chromosome 4
|
What is ADH1B?ADH1B gene is located on Chromosome 4 at 4q23 as shown on the left.
The gene was discovered by Smith et al. (1984) who each used complementary DNA (cDNA cloning), which involves using the reverse-transcriptase enzyme, to convert mRNA into double-stranded cDNA to be cloned within a prokaryotic cell, to determine that all ADH genes are located near chromosome 4q21. Further studies, using Southern blot analysis and in situ hybridization, was able to narrow the location of ADH1B gene to 4q23. (Source: http://www.genecards.org/cgi-bin/carddisp.pl?gene=ADH1B&search=ADH1B) ADH1B, and all genes in the ADH family, are thought to share the common ancestor gene of a gene that coded for a type of formaldehyde dehydrogenase that is identical to a class III alcohol dehydrogenase. Early on in history, this enzyme’s method of eliminating formaldehyde was selected, and a series of mutations created a branch of genes that could process different kinds of alcohol. Yeast evolved the ability to produce ethanol out of sugar, which would allow them to eliminate competitors with the toxic substance. This increase of ethanol caused animals to develop a way to metabolize it.
ADH1B codes for the beta subunit of class I alcohol dehydrogenase (ADH), which manages the rate at which the human body metabolizes ethanol. ADH is also coded for in part by ADH1A and ADH1C. ADH enzyme thus is responsible for a person's level of tolerance of alcoholic beverages, and variants of the ADH genes are linked to a resistance against alcohol dependence. Specifically, people with the variants ADH1B*1 or ADH1B*2, which each cause a slow alcohol metabolism, consume more alcohol and are more likely to be alcoholic. More information on ADH1B structure and history |
As shown above, ADH1B gene includes total of 7 exons.
Role in the Body
According to Smith et al. (1973), ADH1B is expressed in early fetal life in the human lung and continues to be active for life. It becomes active in a child's liver during the first trimester of pregnancy, and increases in activity so that by the time a person reaches adulthood the gene is responsible for the majority of alcohol-related activity in the liver and kidney.
According to the image below, the gene's effects on human’s internal system far outweigh that of any other systems. Shown by results from all three researches, Adipocyte and liver are the two components that hold the highest intensity of ADH1B expression. Adipocytes are cells that store energy as fat. Liver, commonly known, is a tissue responsible of breaking down and detoxifying substances in the body. Excessive ADH1B expression in other systems includes the heart’s muscle system as well as the reproductive system as both shown from Illumina Body Map.
According to the image below, the gene's effects on human’s internal system far outweigh that of any other systems. Shown by results from all three researches, Adipocyte and liver are the two components that hold the highest intensity of ADH1B expression. Adipocytes are cells that store energy as fat. Liver, commonly known, is a tissue responsible of breaking down and detoxifying substances in the body. Excessive ADH1B expression in other systems includes the heart’s muscle system as well as the reproductive system as both shown from Illumina Body Map.
Data collected from 3 different research institutions: BioGPS with 76 normal human tissues and compartments, Illumina body map with RNA obtained from 16 normal tissues, CGAP: SAGE Normal with 19 normal tissues. The tissues and anatomical compartments correspond to 6 categories: immune, nervous, muscle, internal, secretory, and reproductive systems. The corresponding colors are as listed.
|
|
Other gene interactions with ADH1B includes combination of ADH1A, ADH1B, and ADH1C to create the enzyme that metabolizes ethanol, which is the dominant substance in alcohol. In addition, the ADH4, ADH5, ADH6, and ADH7 also influence the breaking down of alcohol. A common mutation in ADH2
Regulation of ADH1B gene expression involve epigenetic mechanism, such as that of DNA methylation and histone deacetylation in the HepG2 human hepatoma cell line. (epigenetic mechanisms) Past experiments show ADH1B decreased its activity by 54% when methylated as the epigenetic mechanisms inhibit the binding processes of upstream region factors of the class 1 ADH genes (ADH1B). These findings suggest that ADH1B gene is repressed when exposed to epigenetic activities.
Souces:
http://www.ncbi.nlm.nih.gov/pubmed/16737450
http://uswest.ensembl.org/Homo_sapiens/Gene/Regulation?db=core;g=ENSG00000196616;r=4:100226121-100242558
Regulation of ADH1B gene expression involve epigenetic mechanism, such as that of DNA methylation and histone deacetylation in the HepG2 human hepatoma cell line. (epigenetic mechanisms) Past experiments show ADH1B decreased its activity by 54% when methylated as the epigenetic mechanisms inhibit the binding processes of upstream region factors of the class 1 ADH genes (ADH1B). These findings suggest that ADH1B gene is repressed when exposed to epigenetic activities.
Souces:
http://www.ncbi.nlm.nih.gov/pubmed/16737450
http://uswest.ensembl.org/Homo_sapiens/Gene/Regulation?db=core;g=ENSG00000196616;r=4:100226121-100242558
Alcohol Dehydrogenase Protein
|
The protein ADH has three binding sites, one for nicotinamide adenine dinucleotide (NAD+) and two for zinc ions (Zn2+). The zinc ions bind between Cys-46, His-67, Cys-17, and a water molecule. NAD+ binds nearby, and so does ethanol, the molecule to be metabolized. NAD+ is used via proton transfer to convert ethanol to a far more toxic acetaldehyde. Zinc removes two electrons from ethanol. In the process, water molecules are consumed, resulting in possible dehydration.
The ADH protein serves to convert ethanol or ethyl alcohol into Acetaldehyde and hydrogen. ADH removes the hydrogen using zinc, NAD+ , and water. Thus, in the process of metabolizing ethanol, a person may become dehydrated.
Source: http://www.rcsb.org/pdb/101/motm.do?momID=13 |
Significance of ADH1B Research
|
East Asian patients diagnosed with esophageal squamous cell carcinoma, a type of non-melanoma skin cancer, could be suspected of low activity in ADH1B. A recent study suggests that mutations in ADH1B spike the risk of getting esophageal squamous cell carcinoma specifically in the Taiwanese population. Genetic polymorphisms in ADH1B could also result in colorectal carcinogenesis.
Knowing about this gene is crucial to how we define and look at alcoholism, and how to combat it. The ADH1B gene shows us that alcoholism is not 100% personal choice. People with a mutant form of ADH1B could be at a much higher risk, or lower risk, of developing an alcohol dependence than someone with a normal version. Using that, we could determine who has a high chance of developing alcoholism at a young age, and help educate them early on how to prevent it.
|
Sources:
http://www.nytimes.com/2010/07/20/science/20adapt.html?pagewanted=all
|
The Lab
The goal of our lab was to isolate and amplify the ADH1B gene. We selected primers that, after the process of Polymerase Chain Reaction (PCR), would yield a product of a size that move smoothly through agarose gel during gel electrophoresis. We used the a left primer with the sequence AGAACAGTGCGTGTCCTAAC and a GC% of 55%, and a left primer with the sequence AGGTCGCCCTTGTGGAGATA and a GC% of 50%. GC% is the percentage of all the bases in a given sequence that are either Guanine or Cytosine. This was important because these two nucleotides had a stronger bond, and two many of these pairs would make performing PCR more difficult. The final product from PCR had a length of 288 base pairs.
