TET1
An Introduction
Li-Huei Tsai, director of MIT’s Picower Institute for Learning and Memory, stated: “For more than a half century it has been documented that gene expression and protein synthesis are essential for learning and forming new memories. . . . we speculated that the Tet1 gene regulates chemical modifications to DNA.” Through a series of experiments (one of which is explained in the section Medical Uses and the Future of Tet1), Tsai and his team proved this speculation. Tet1, a member of the Tet protein family responsible for gene regulation and modification, plays a crucial role in memory encoding and memory extinction.
Instead of encoding for a single, specific trait, Tet1 changes the rate of DNA methylation — the process by which a methyl group is added to the A or C nucleotides. When methylation levels are high, specific gene expression is blocked. Conversely, when methylation levels are low, the same genes are turned on. According to Tsai’s studies, lack of Tet1 proteins leads to lower levels “significantly lower levels of hydroxymethylation - the process leading to the removal of methylation - in both the hippocampus and cortex of the brain” — two areas essential to the process of learning and encoding information and memories.
Li-Huei Tsai, director of MIT’s Picower Institute for Learning and Memory, stated: “For more than a half century it has been documented that gene expression and protein synthesis are essential for learning and forming new memories. . . . we speculated that the Tet1 gene regulates chemical modifications to DNA.” Through a series of experiments (one of which is explained in the section Medical Uses and the Future of Tet1), Tsai and his team proved this speculation. Tet1, a member of the Tet protein family responsible for gene regulation and modification, plays a crucial role in memory encoding and memory extinction.
Instead of encoding for a single, specific trait, Tet1 changes the rate of DNA methylation — the process by which a methyl group is added to the A or C nucleotides. When methylation levels are high, specific gene expression is blocked. Conversely, when methylation levels are low, the same genes are turned on. According to Tsai’s studies, lack of Tet1 proteins leads to lower levels “significantly lower levels of hydroxymethylation - the process leading to the removal of methylation - in both the hippocampus and cortex of the brain” — two areas essential to the process of learning and encoding information and memories.
History & Discovery
Since some of the most substantial epigenetic research has come to fruition in the last ten years, it isn’t that surprising that scientists have only recently been able to fully understand the powers of the TET1 gene. After MIT’s study in 2013 linked TET1 to memory extinction capabilities in the hippocampus and cortex, the gene began receiving more attention. Today we know that TET1 is located on 10q21 and regulates 5hmC, 5mC (dna pyrimidine nitrogen base) and gene expression in the cell.
Medical Uses and the Future of Tet1:
A 2013 study conducted by several researched from the Massachusetts Institute of Technology concluded that Tet1 could play a revolutionary role in the treatment of post-traumatic stress disorder (PTSD). The basics of the study were relatively simple: researchers conditioned two groups of mice — one with normal levels of Tet1 and the other with the gene completely muted — to fear a cage that administered a minor electric shock. When both groups of mice had adequately encoded the association between shock and cage into their memories, they were returned to the cage, but not shocked. At first, both groups of mice remained logically afraid of the cage, but after several safe experiences, the mice with normal levels of Tet1 demonstrated diminished or nonexistent levels of fear. Conversely, the mice with non-functional Tet1 genes remained afraid when placed in the cage.
According to Robert Rescorla, a prominent experimental psychologist, for conditioning to be successful a stimulus must be both reliable and informative. In the context of the MIT study, this principle means the cage and only the cage must always indicate a coming shock. In spite of the fact that the cage no longer functioned as a reliable nor informative stimulus, the fear in the group of rats lacking Tet1 did not dissipate. While the normal rats were able to overlay new, non-fearful memories on top of old ones, the rats without Tet1 could not change or replace previously encoded experience — they were stuck in a state of fear whenever in the cage.
While this study may not at first appear particularly medically significant, the results suggest a powerful conclusion: if scientists were able to increase Tet1 levels in PTSD patients, traumatic memories could be partially or wholly replaced by more neutral ones. According to Li-Huei Tsai, "What happens during memory extinction is not erasure of the original memory. The old trace of memory is telling the mice that this place is dangerous. But the new memory informs the mice that this place is actually safe. There are two choices of memory that are competing with each other." PTSD patients with increased levels of Tet1 would not misremember traumatic events as happy or neutral, but rather have the capacity to more easily overlay and encode new, less traumatic events instead of revisiting and becoming encapsulated in old, distressing events.
Running PCR:
Using our own DNA, we ran PCR to isolate and amplify our gene. We used an online database to determine the appropriate left and right hand primers (CTGATGTATCCCCCGAAGCC and TCGGAGTTGAAATGGGCGAA) to yield a 292 base pair strand of TET1. To read about the full process of PCR, visit this site: http://www.ndsu.edu/pubweb/~mcclean/plsc431/cloning/clone9.htm.
During the process, we accidentally contaminated one test tube of DNA by adding Master Mix at the wrong stage. Consequently, we ended up only completing the full PCR process once. Luckily, the gene was clearly isolated and the correct length. Check out the image below — our Tet1 DNA is in slot number two, and slot number three is a pre-calibrated ladder.
A 2013 study conducted by several researched from the Massachusetts Institute of Technology concluded that Tet1 could play a revolutionary role in the treatment of post-traumatic stress disorder (PTSD). The basics of the study were relatively simple: researchers conditioned two groups of mice — one with normal levels of Tet1 and the other with the gene completely muted — to fear a cage that administered a minor electric shock. When both groups of mice had adequately encoded the association between shock and cage into their memories, they were returned to the cage, but not shocked. At first, both groups of mice remained logically afraid of the cage, but after several safe experiences, the mice with normal levels of Tet1 demonstrated diminished or nonexistent levels of fear. Conversely, the mice with non-functional Tet1 genes remained afraid when placed in the cage.
According to Robert Rescorla, a prominent experimental psychologist, for conditioning to be successful a stimulus must be both reliable and informative. In the context of the MIT study, this principle means the cage and only the cage must always indicate a coming shock. In spite of the fact that the cage no longer functioned as a reliable nor informative stimulus, the fear in the group of rats lacking Tet1 did not dissipate. While the normal rats were able to overlay new, non-fearful memories on top of old ones, the rats without Tet1 could not change or replace previously encoded experience — they were stuck in a state of fear whenever in the cage.
While this study may not at first appear particularly medically significant, the results suggest a powerful conclusion: if scientists were able to increase Tet1 levels in PTSD patients, traumatic memories could be partially or wholly replaced by more neutral ones. According to Li-Huei Tsai, "What happens during memory extinction is not erasure of the original memory. The old trace of memory is telling the mice that this place is dangerous. But the new memory informs the mice that this place is actually safe. There are two choices of memory that are competing with each other." PTSD patients with increased levels of Tet1 would not misremember traumatic events as happy or neutral, but rather have the capacity to more easily overlay and encode new, less traumatic events instead of revisiting and becoming encapsulated in old, distressing events.
Running PCR:
Using our own DNA, we ran PCR to isolate and amplify our gene. We used an online database to determine the appropriate left and right hand primers (CTGATGTATCCCCCGAAGCC and TCGGAGTTGAAATGGGCGAA) to yield a 292 base pair strand of TET1. To read about the full process of PCR, visit this site: http://www.ndsu.edu/pubweb/~mcclean/plsc431/cloning/clone9.htm.
During the process, we accidentally contaminated one test tube of DNA by adding Master Mix at the wrong stage. Consequently, we ended up only completing the full PCR process once. Luckily, the gene was clearly isolated and the correct length. Check out the image below — our Tet1 DNA is in slot number two, and slot number three is a pre-calibrated ladder.
Bibliography
Brain2. Photograph. www.flickr.com. Accessed May 20, 2014. https://www.flickr.com/photos/jetheriot/6186786217/in/photolist-aqGTZT-2n8Bx9-6xb9Ws-6Fe8sm-gLGmYp-7wXNwo-6RwrC-diBui-fJtuwn-4w9CCN-v4E7B-92HT9A-8QdsRC-dgDcuK-2H2dKd-dbLQJH-7DHn4r-niwG-8mLBe4-5wxWqy-EFzQB-hFf1Wn-6bySW-frCnpk-iVE8eA-4w4Efe-4Epycp-wKLw6-G9PtQ-ijtcDD-61eaPC-jb66eP-8dnMuZ-4A87pT-5nzQc-6R2fb6-8WD27T-bCcqCM-51rRGn-e4kFLD-5kpAF6-5jBQiu-8TawLT-7PNw6M-7LtZVR-5kYwkW-7DM2Xq-dR2mk1-DhAMD-3jmeg/.
Greenberg, Paul. “Bad Memories Could Be ‘Erased.’” Discovery News. Discovery Communications LLC, 24 Sept. 2103. Web. 18 May 2014. <http://news.discovery.com/human/psychology/bad-memories-could-be-erased-130924.htm>.
Pills Blue and Red. Photograph. mirror-us-ga1.gallery.hd.org. Accessed May 16, 2014. http://mirror-us-ga1.gallery.hd.org/_exhibits/medicine/pills-blue-and-red-AJHD.jpg.
Rudenko, et al. “Tet1 is critical for neuronal activity-regulated gene expression and memory extinction.” Neuron 8 (2013): n. pag. US National Library of Medicine. Web. 18 May 2014. <http://www.ncbi.nlm.nih.gov/pubmed/24050401>.
Trafton, Anne. “How Old Memories Fade Away.” MIT News. MIT News Office, 18 Sept. 2013. Web. 20 May 2014. <http://newsoffice.mit.edu/2013/how-old-memories-fade-away-0918>.
Whiteman, Honor. “Gene that triggers ‘memory extinction’ discovered.” Medical News Today. MedLexicon International LLC, 21 Sept. 2013. Web. 18 May 2014. <http://www.medicalnewstoday.com/articles/266368.php>.
Brain2. Photograph. www.flickr.com. Accessed May 20, 2014. https://www.flickr.com/photos/jetheriot/6186786217/in/photolist-aqGTZT-2n8Bx9-6xb9Ws-6Fe8sm-gLGmYp-7wXNwo-6RwrC-diBui-fJtuwn-4w9CCN-v4E7B-92HT9A-8QdsRC-dgDcuK-2H2dKd-dbLQJH-7DHn4r-niwG-8mLBe4-5wxWqy-EFzQB-hFf1Wn-6bySW-frCnpk-iVE8eA-4w4Efe-4Epycp-wKLw6-G9PtQ-ijtcDD-61eaPC-jb66eP-8dnMuZ-4A87pT-5nzQc-6R2fb6-8WD27T-bCcqCM-51rRGn-e4kFLD-5kpAF6-5jBQiu-8TawLT-7PNw6M-7LtZVR-5kYwkW-7DM2Xq-dR2mk1-DhAMD-3jmeg/.
Greenberg, Paul. “Bad Memories Could Be ‘Erased.’” Discovery News. Discovery Communications LLC, 24 Sept. 2103. Web. 18 May 2014. <http://news.discovery.com/human/psychology/bad-memories-could-be-erased-130924.htm>.
Pills Blue and Red. Photograph. mirror-us-ga1.gallery.hd.org. Accessed May 16, 2014. http://mirror-us-ga1.gallery.hd.org/_exhibits/medicine/pills-blue-and-red-AJHD.jpg.
Rudenko, et al. “Tet1 is critical for neuronal activity-regulated gene expression and memory extinction.” Neuron 8 (2013): n. pag. US National Library of Medicine. Web. 18 May 2014. <http://www.ncbi.nlm.nih.gov/pubmed/24050401>.
Trafton, Anne. “How Old Memories Fade Away.” MIT News. MIT News Office, 18 Sept. 2013. Web. 20 May 2014. <http://newsoffice.mit.edu/2013/how-old-memories-fade-away-0918>.
Whiteman, Honor. “Gene that triggers ‘memory extinction’ discovered.” Medical News Today. MedLexicon International LLC, 21 Sept. 2013. Web. 18 May 2014. <http://www.medicalnewstoday.com/articles/266368.php>.
